Southeast Asian J Trop Med Public Health

The stability of DNA in dried blood samples obtained from the neonatal screening program in Thailand was retrospectively studied in order to determine the conditions necessary for the long term storage of samples for DNA banking. Specimens from 1991 to 2001, which had been kept in the ambient conditions at the Department of Medical Science, Ministry of Public Health, Thailand, were randomly sampled and used for the study. Genomic DNA was extracted from the samples and DNA fragments of the PAX8 and β-globin genes were amplified by PCR to determine DNA stability. The study showed that 255-bp and 674-bp fragments of the PAX8 gene could be amplified from all the samples. The DNA fragment of 1,039 bp of the β-globin gene could be detected in all of the samples for the years 1993 to 2001, but only in seven and five out of the ten studied samples for each of the years 1991 and 1992, respectively. Our study shows that genomic DNA is stable in dried blood stored on filter paper at ambient tropical conditions for at least 11 years. However, DNA quality for amplification of larger DNA fragments decreased when the specimens were stored for longer than 10 years. health purposes, such as genetic and epidemiologic studies, or for establishing DNA detection method(s) for the screening of inborn diseases commonly occurring in Thai populations. Dried blood samples have also been used for DNA detection analysis in newborn screening to identify genetic mutation diseases, such as cystic fibrosis (Seltzer et al, 1991; Audrezet et al, 1993; Farrell et al, 1994) and sickle cell disease (Jinks et al, 1989; Skogerboe et al, 1991). The dried blood specimens from the National Neonatal Screening Program in Thailand have been retained for a long period based on the stalability of DNA is the most stable analyte in dried blood (Therrell et al, 1996) and an important tool for population-based genetic studies. To our knowledge, there have been no published data regarding the effects of long-term storage of dried blood specimens on the stability of genomic DNA. Casole and colleages (Cassol et al, 1992) showed that the maximum length of stability of HIV proviral DNA in dried blood spots kept at ambient temperature and dessicated at -20oC was about 3.5 months. βglobin DNA has been detected in dried blood stored at ambient temperature for about 1 year (Rubin et al, 1989). However, most stability studDNA STABILITY IN DRIED BLOOD SPOTS Vol 36 No. 1 January 2005 271 ies on dried blood specimens have shown inconsistent result (Therrell et al, 1996). We carried out this study to determine the stability of genomic DNA in dried blood specimens collected and retained for the National Neonatal Screening Program in Thailand from the years 1991 to 2001. The results should provide information regarding duration and conditions for storage of the specimens, which can be used for decision making regarding long term storage of dried blood specimens for a DNA bank in Thailand. MATERIALS AND METHODS Dried blood spot samples Dried blood spot specimens retained for the National Neonatal Screening Program in Thailand during the years 1991 to 2001 were used for the study. Blood specimens were collected on filter paper (Schleicher and Schuell, Keene NH, USA) following National Committee on Clinical Laboratory Standards (NCCLS) specifications (Hannon et al, 1997). They were stored in sealed plastic bags at the Department of Medical Sciences, Ministry of Public Health, Nonthaburi, Thailand, at an average tmperature of 28±2oC and 73±5% relative humidity. Ten blood specimens were randomly sampled from the stock of residual dried blood specimens for each year collection. All the samples were from the same province, participating in the program since 1991. Sample variation, occurring from variations in blood collection techniques was eliminated. The samples were kept at 4oC during the study. Extraction and purification of genomic DNA from dried blood on filter paper Genomic DNA was extracted and purified from dried blood samples using the method previously described (Chaisomchit et al, 2003). Extraction of genomic DNA from whole blood Blood samples obtained from a volunteer with written consent were freshly collected in an EDTA-coated tube (Vacuette, Greiner Labortecnik, Austria). Lymphocytes were prepared from peripheral blood samples as previously described (Chaisomchit et al, 2003). PCR analyses of the 255-bp and 674-bp fragment of the PAX8 gene PCR amplification of the 255-bp fragment exon 5 of the PAX8 gene (11) was performed using the following primers 5′ TCTCCCTCTC CCCCACTG 3′ and 5′ GCAGAGCCCCTAC AAAGTCC 3′ for amplification of the 255-bp fragment and 5′ TCTCCCTCTCCCCCACTG 3′ and 5′ CACAGGCTCATTTGGAGAAT 3′ for amplification of the 674-bp fragment. PCR reactions were carried out in the Perkin Elmer 9600 Thermocycler machine using conditions described previously (Chaisomchit et al, 2003). Genomic DNA extracted from fresh blood was used as a positive control. The amplified products were analyzed by agarose gel-electrophoresis. PCR analysis of the 1,039-bp fragment of the β-globin gene To amplify the β-globin gene, the primers 5′ TGCCTATTGGTCTATTTTCC 3′ and 5′ AATCC AGCCTTATCCCAACC 3′ were used. The cycling profile consisted of one cycle of template denaturation at 94oC for 2 minutes, 40 cycles of denaturation at 94oC for 30 seconds, and annealing and extension at 60oC for 1 minute 30 seconds, followed by one cycle at 70oC for 5 minutes. The PCR product was analyzed by agarose gel-electrophoresis.